| 產(chǎn)品名稱(chēng) |
Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx |
| 商品貨號(hào) |
B167653 |
| Deposited As |
Mycoderma lipolytica |
| Strain Designations |
251 [CBS 2072, IFO 1742, KCM-0232] |
| Synonym |
Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow |
| Alternate State |
Candida lipolytica (Harrison) Diddens et Lodder |
| Application |
Control strain for identification
Quality control strain |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
freeze-dried |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
no |
| Preceptrol® |
yes |
| Comments |
Growth factor |
| Morphology |
After 3 days on YM agar at 25°C, colonies are white, raised, wrinkled and dull. Cells are ovoid to cylindrical, pseudohyphae abundant and well-differentiated. |
| Medium |
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
|
| Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTATCTATTTCTGTGGATTTCTATTCTATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACCTCCTTCATCCGAGATTACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 26S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAATCCACCCATTTCAC
|
| Name of Depositor |
PR Burkholder |
| Cross References |
Nucleotide (GenBank) :
EU252546
ITS including 5.8S rRNA gene
|
| References |
Burkholder PR, et al. Studies on some growth factors of yeasts. J. Bacteriol. 48: 385-391, 1944.
Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903
Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320
RapID™ Yeast PLUS QC Set. Remel™.
Arteau M, Labrie S, Roy D. Terminal-restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis profiling of fungal communities in Camembert cheese. Int. Dairy J. 20: 545-554, 2010.
|
